aboutsummaryrefslogtreecommitdiff
path: root/src/test/bench/shootout
diff options
context:
space:
mode:
authorGraydon Hoare <[email protected]>2010-09-15 18:22:10 -0700
committerGraydon Hoare <[email protected]>2010-09-15 18:22:10 -0700
commitcd1a765c6f635c7cf9d39a46f42c93a2cbbf1982 (patch)
tree2ac85f1ed7ede99a498f90dd0ecb56239b4e92f9 /src/test/bench/shootout
parentMinor improvements to pretty-printer. (diff)
downloadrust-cd1a765c6f635c7cf9d39a46f42c93a2cbbf1982.tar.xz
rust-cd1a765c6f635c7cf9d39a46f42c93a2cbbf1982.zip
Add Peter Hull's contributed translation of the fasta shootout benchmark (integer-only version).
Diffstat (limited to 'src/test/bench/shootout')
-rw-r--r--src/test/bench/shootout/binary-trees.rs5
-rw-r--r--src/test/bench/shootout/fasta.rs127
2 files changed, 131 insertions, 1 deletions
diff --git a/src/test/bench/shootout/binary-trees.rs b/src/test/bench/shootout/binary-trees.rs
index bb3ab602..669cd809 100644
--- a/src/test/bench/shootout/binary-trees.rs
+++ b/src/test/bench/shootout/binary-trees.rs
@@ -1,4 +1,7 @@
-type tree = tag(nil(), node(@tree, @tree, int));
+tag tree {
+ nil();
+ node(@tree, @tree, int);
+}
fn item_check(&tree t) -> int {
alt (t) {
diff --git a/src/test/bench/shootout/fasta.rs b/src/test/bench/shootout/fasta.rs
new file mode 100644
index 00000000..ffec6db9
--- /dev/null
+++ b/src/test/bench/shootout/fasta.rs
@@ -0,0 +1,127 @@
+/* -*- mode: rust; indent-tabs-mode: nil -*-
+ * Implementation of 'fasta' benchmark from
+ * Computer Language Benchmarks Game
+ * http://shootout.alioth.debian.org/
+ */
+use std;
+import std._vec;
+import std._str;
+import std._uint;
+import std._int;
+
+fn LINE_LENGTH() -> uint {
+ ret 60u;
+}
+
+obj myrandom(mutable u32 last) {
+ fn next(u32 mx) -> u32 {
+ last = (last * 3877u32 + 29573u32) % 139968u32;
+ auto ans = (mx*last) / 139968u32;
+ ret ans;
+ }
+}
+
+type aminoacids = tup(char, u32);
+
+fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] {
+ let u32 cp = 0u32;
+ let vec[aminoacids] ans = vec();
+ for (aminoacids a in aa) {
+ cp += a._1;
+ ans += tup(a._0, cp);
+ }
+ ret ans;
+}
+
+fn select_random(u32 r, vec[aminoacids] genelist) -> char {
+ if (r < genelist.(0)._1) {
+ ret genelist.(0)._0;
+ }
+ fn bisect(vec[aminoacids] v, uint lo, uint hi, u32 target) -> char {
+ if (hi > (lo + 1u)) {
+ let uint mid = lo + (hi - lo) / 2u;
+ if (target < v.(mid)._1) {
+ be bisect(v, lo, mid, target);
+ }
+ else {
+ be bisect(v, mid, hi, target);
+ }
+ }
+ else {
+ ret v.(hi)._0;
+ }
+ }
+ ret bisect(genelist, 0u, _vec.len[aminoacids](genelist) - 1u, r);
+}
+
+fn make_random_fasta(str id, str desc, vec[aminoacids] genelist, int n) {
+ log(">" + id + " " + desc);
+ auto rng = myrandom(std.rand.mk_rng().next());
+ let str op = "";
+ for each (uint i in _uint.range(0u, n as uint)) {
+ op += select_random(rng.next(100u32), genelist) as u8;
+ if (_str.byte_len(op) >= LINE_LENGTH()) {
+ log(op);
+ op = "";
+ }
+ }
+ if (_str.byte_len(op) > 0u) {
+ log(op);
+ }
+}
+
+fn make_repeat_fasta(str id, str desc, str s, int n) {
+ log(">" + id + " " + desc);
+ let str op = "";
+ let uint sl = _str.byte_len(s);
+ for each (uint i in _uint.range(0u, n as uint)) {
+
+ op += s.(i % sl);
+ if (_str.byte_len(op) >= LINE_LENGTH()) {
+ log(op);
+ op = "";
+ }
+ }
+ if (_str.byte_len(op) > 0u) {
+ log(op);
+ }
+}
+
+fn main(vec[str] args) {
+ let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ),
+ tup( 'c', 12u32 ),
+ tup( 'g', 12u32 ),
+ tup( 't', 27u32 ),
+
+ tup( 'B', 2u32 ),
+ tup( 'D', 2u32 ),
+ tup( 'H', 2u32 ),
+ tup( 'K', 2u32 ),
+ tup( 'M', 2u32 ),
+ tup( 'N', 2u32 ),
+ tup( 'R', 2u32 ),
+ tup( 'S', 2u32 ),
+ tup( 'V', 2u32 ),
+ tup( 'W', 2u32 ),
+ tup( 'Y', 2u32 )));
+
+ let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ),
+ tup( 'c', 20u32 ),
+ tup( 'g', 20u32 ),
+ tup( 't', 30u32 )));
+
+ let str alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+ let int n = 512;
+
+ make_repeat_fasta ("ONE", "Homo sapiens alu", alu, n*2);
+ make_random_fasta("TWO", "IUB ambiguity codes", iub, n*3);
+ make_random_fasta ("THREE", "Homo sapiens frequency", homosapiens, n*5);
+}