diff options
| author | Graydon Hoare <[email protected]> | 2010-09-15 18:22:10 -0700 |
|---|---|---|
| committer | Graydon Hoare <[email protected]> | 2010-09-15 18:22:10 -0700 |
| commit | cd1a765c6f635c7cf9d39a46f42c93a2cbbf1982 (patch) | |
| tree | 2ac85f1ed7ede99a498f90dd0ecb56239b4e92f9 /src/test/bench/shootout | |
| parent | Minor improvements to pretty-printer. (diff) | |
| download | archived-rust-cd1a765c6f635c7cf9d39a46f42c93a2cbbf1982.tar.xz archived-rust-cd1a765c6f635c7cf9d39a46f42c93a2cbbf1982.zip | |
Add Peter Hull's contributed translation of the fasta shootout benchmark (integer-only version).
Diffstat (limited to 'src/test/bench/shootout')
| -rw-r--r-- | src/test/bench/shootout/binary-trees.rs | 5 | ||||
| -rw-r--r-- | src/test/bench/shootout/fasta.rs | 127 |
2 files changed, 131 insertions, 1 deletions
diff --git a/src/test/bench/shootout/binary-trees.rs b/src/test/bench/shootout/binary-trees.rs index bb3ab602..669cd809 100644 --- a/src/test/bench/shootout/binary-trees.rs +++ b/src/test/bench/shootout/binary-trees.rs @@ -1,4 +1,7 @@ -type tree = tag(nil(), node(@tree, @tree, int)); +tag tree { + nil(); + node(@tree, @tree, int); +} fn item_check(&tree t) -> int { alt (t) { diff --git a/src/test/bench/shootout/fasta.rs b/src/test/bench/shootout/fasta.rs new file mode 100644 index 00000000..ffec6db9 --- /dev/null +++ b/src/test/bench/shootout/fasta.rs @@ -0,0 +1,127 @@ +/* -*- mode: rust; indent-tabs-mode: nil -*- + * Implementation of 'fasta' benchmark from + * Computer Language Benchmarks Game + * http://shootout.alioth.debian.org/ + */ +use std; +import std._vec; +import std._str; +import std._uint; +import std._int; + +fn LINE_LENGTH() -> uint { + ret 60u; +} + +obj myrandom(mutable u32 last) { + fn next(u32 mx) -> u32 { + last = (last * 3877u32 + 29573u32) % 139968u32; + auto ans = (mx*last) / 139968u32; + ret ans; + } +} + +type aminoacids = tup(char, u32); + +fn make_cumulative(vec[aminoacids] aa) -> vec[aminoacids] { + let u32 cp = 0u32; + let vec[aminoacids] ans = vec(); + for (aminoacids a in aa) { + cp += a._1; + ans += tup(a._0, cp); + } + ret ans; +} + +fn select_random(u32 r, vec[aminoacids] genelist) -> char { + if (r < genelist.(0)._1) { + ret genelist.(0)._0; + } + fn bisect(vec[aminoacids] v, uint lo, uint hi, u32 target) -> char { + if (hi > (lo + 1u)) { + let uint mid = lo + (hi - lo) / 2u; + if (target < v.(mid)._1) { + be bisect(v, lo, mid, target); + } + else { + be bisect(v, mid, hi, target); + } + } + else { + ret v.(hi)._0; + } + } + ret bisect(genelist, 0u, _vec.len[aminoacids](genelist) - 1u, r); +} + +fn make_random_fasta(str id, str desc, vec[aminoacids] genelist, int n) { + log(">" + id + " " + desc); + auto rng = myrandom(std.rand.mk_rng().next()); + let str op = ""; + for each (uint i in _uint.range(0u, n as uint)) { + op += select_random(rng.next(100u32), genelist) as u8; + if (_str.byte_len(op) >= LINE_LENGTH()) { + log(op); + op = ""; + } + } + if (_str.byte_len(op) > 0u) { + log(op); + } +} + +fn make_repeat_fasta(str id, str desc, str s, int n) { + log(">" + id + " " + desc); + let str op = ""; + let uint sl = _str.byte_len(s); + for each (uint i in _uint.range(0u, n as uint)) { + + op += s.(i % sl); + if (_str.byte_len(op) >= LINE_LENGTH()) { + log(op); + op = ""; + } + } + if (_str.byte_len(op) > 0u) { + log(op); + } +} + +fn main(vec[str] args) { + let vec[aminoacids] iub = make_cumulative(vec(tup( 'a', 27u32 ), + tup( 'c', 12u32 ), + tup( 'g', 12u32 ), + tup( 't', 27u32 ), + + tup( 'B', 2u32 ), + tup( 'D', 2u32 ), + tup( 'H', 2u32 ), + tup( 'K', 2u32 ), + tup( 'M', 2u32 ), + tup( 'N', 2u32 ), + tup( 'R', 2u32 ), + tup( 'S', 2u32 ), + tup( 'V', 2u32 ), + tup( 'W', 2u32 ), + tup( 'Y', 2u32 ))); + + let vec[aminoacids] homosapiens = make_cumulative(vec(tup( 'a', 30u32 ), + tup( 'c', 20u32 ), + tup( 'g', 20u32 ), + tup( 't', 30u32 ))); + + let str alu = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + + let int n = 512; + + make_repeat_fasta ("ONE", "Homo sapiens alu", alu, n*2); + make_random_fasta("TWO", "IUB ambiguity codes", iub, n*3); + make_random_fasta ("THREE", "Homo sapiens frequency", homosapiens, n*5); +} |